Ef1a short promoter

Ef1a short promoter. The “Sp” stands for the organism, Streptococcus pyogenes, from which this Jan 1, 2023 · As mentioned above, the crystal and NMR-derived structures of the individual eEF1Bγ domains are known. This means that in these cell types, long-term tetracycline-inducible expression can be achieved. Analyze Sequence. Unfortunately, only one line had low levels of hACE2 expression Mar 14, 2012 · Promoter-targeted RNA-induced transcriptional gene silencing sometimes occurs in the presence of a promoter with DNA methylation . It catalyzes the binding of aminoacyl-tRNA to the A-site of the ribosome in a GTP-dependent manner during protein synthesis, although it also seems to play a role in other non-translational processes. doi: 10. , 2003 ). 4 kb EF1α:EGFP) construct contains the 2310 bp promoter and the 1059 bp first intron sequence, whereas the p(−2. In this study, we report the development of transgenic zebrafish line named as Tg ( EF1α:Kaede) that expresses translation elongation factor 1 subunit alpha (EF1α) promoter linked to a fluorescent protein (FP), Kaede for monitoring proliferating cells in during regeneration Constitutive promoters are used routinely to drive ectopic gene expression. 3 ), you will see that Cas9 is written as eSpCas9. Tight regulation of mRNA stability and access to polysomes allows Trypanosoma cruzi to adapt to different environmental conditions during its life cycle. SnapGene. Notably, pGK300-BBZ exhibited reduced surface CAR density, barely eradicated the inoculated tumor cells, and the Also plays a role in the positive regulation of IFNG transcription in T-helper 1 cells as part of an IFNG promoter-binding complex with TXK and PARP1 (PubMed:17177976). Materials and methods: We compared the efficacy of the CMV promoter to the promoter of the elongation factor-1 alpha (EF-1 alpha) for the generation of stable colon carcinoma cell lines (HT-29). 11:783 (2014) Proc Natl Acad Sci U S A. 3 Since the spontaneous rate of GDP dissociation from eEF1A is very slow with an equilibrium dissociation The cytomegalovirus IE en-hancer and chicken -actin promoter (CAG) drives β high level of transgene expression and is one of the most commonly used promoters for gene transfer (Xu et al. Such promoter-targeted RNAs have silenced elongation factor 1alpha (EF1A) transcription in human cells and has been implicated with DNA-methyltransferase (DNMT3A)-dependent DNA methylation. Oct 21, 2011 · Our studies indicate that the potency of knockdown using shRNA-miRs is largely determined by the relative promoter strength of the polymerase II promoter that drives expression of the shRNA, and that large variations in target knockdown occur due to the differential potency of such promoters in different cell types. gigas EF-1α promoter sequence. However, the role of EF1A in abiotic stress response was barely studied in Medicago truncatula. Unexpectedly, both the 16EF and 14EF promoters showed higher activity levels than the original EF1a promoter ( Figure 2 ). EF-Tu/eEF1α is a principal member of the homologous translational GTPase family. The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm. We combined the homology-modeling approach and HDX analysis to develop an atomistic model that shows that eEF1Bγ is a non-globular protein with a moderately elongated shape, which consists of two rigidly structured domains connected by a long, highly dynamic linker (Fig. MATERIALS AND METHODS We compared the efficacy of the CMV promoter to the promoter of the elongation factor-1 alpha (EF-1 alpha) for the generation of stable colon carcinoma cell lines (HT-29). Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions from the transcription start site (TSS). Dec 1, 1999 · In addition, this study demonstrates the importance of examining alternatives to widely used expression constructs based on strong viral promoters since they are more likely to be suited for short-term transient studies, particularly in a given cell type-specific context. Dec 12, 2021 · The two promoters tested in this work (i. Two plasmids were constructed using the C. 1%, and 29% higher transgene expression at 5 ng, 10 ng, and 25 ng p24 equivalents compared with T cells transduced with vectors driven by the The EF1a promoter-associated RNA is required for RNA-directed epigenetic modiﬁcations at the EF1a promoter. The novel CHEF1 promoter system described here enables high-level transgene expression in the stably transfected hESC. Sticky ends from different BspMI sites may not be compatible. Nat Methods. To identify the promoter region of the EF-1 alpha gene necessary for efficient gene expression, we constructed The elongation factor 1α short (EFS) promoter mediated the most robust expression, whereas expression levels were lower from the potent but more silencing-prone spleen focus forming virus (SFFV) promoter. Gene 1990; 91: 217–223. 6 publications (Microbial infection) Required for the translation of viral proteins and viral replication during human coronavirus SARS-CoV-2 infection. 3 kb EF1α:EGFP) construct contains the promoter without the first intron. Posttranscriptional regulation requires association between mRNAs and specific proteins to form mRNP complexes. May 19, 2015 · Background Regulation of gene expression in trypanosomatids is mainly posttranscriptional. 4 days ago · EF1A: Human eukaryotic translation elongation factor 1 α1 promoter: Strong promoter. In addition, long-term cultivation of many candidate lines derived in the absence of drug selection pressure is necessary. S1D) were generated by polymerase chain reaction (PCR). Dec 6, 2014 · EF1alpha (or its short, intron-less form, EFS) is a promoter that has been recently used in many clinical trials. Currently, little information is still available about pLenti-EF1a-C-tGFP, Lenti Vector with EF1 alpha promoter and C-terminal tGFP tag, 10ug Modular CD8hinge-CD28transmembrane-CD28-41BB-CD3z CAR backbone, For Transient Expression or Lentiviral Production Dec 1, 2013 · To drive gene expression, internal promoters are essential; however, the in vivo properties of promoters, such as their cell type specificity and gene expression activity, are not well known, especially in the nonhuman primate brain. Plasmid JZ901: pMVP (L5-L4) EF1a promoter from Dr. It may have signi, cant implication for uses in bioprocess development and future development of gene-modified hESC in tissue regeneration and transplantation applications. The efficacy of the human elongation factor 1-alpha (EF1α) promoter in driving gene expression in neurons is a subject of interest in neuroscience May 12, 2010 · The maximum expression level from the TRE promoter in any of the cell types is comparable to, or only slightly less than, a strong constitutive promoter such as EF1A or CAGG in that cell type (compare maximum TRE activities with that of other promoters in Figures 1 and and2). (In addition to the EF1a promoter, the EF1a-short /EFS promoter is also worth testing, as the EF1a promoter contains an intron that gets removed EF1 promoter (Ubiquitous) in pDRIVE expression plasmid The EF-1 alpha gene encoding elongation factor-1 alpha is an enzyme which catalyzes the GTP-dependent binding of aminoacyl-tRNA to ribosomes. moter, a short intron-less version derived from human EF1a,to drive eGFP expression (Figure 1A; EFS, open bar). Vector particles pseudotyped with vesicular stomatitis virus glycoprotein (VSV-G) were produced, Oct 15, 2018 · The CAG promoter is a strong promoter, which can significantly drive the expression of exogenous genes (Roodbari et al. Connie Cepko's lab contains the insert EF1 alpha promoter and is published in Proc Natl Acad Sci U S A. 28,37 As a refer-ence, we used the same vectors carrying the potent SFFV promoter (Figure 1A; SFFV, ﬁlled bar). To produce lentiviral … Apr 1, 2008 · We focused our analysis on two widely used retroviral enhancer–promoters derived from the U3 region of myeloproliferative sarcoma virus (MPSV) or SFFV, and two well-known cellular promoters derived from human genes, namely, PGK and EFS, the latter representing a short, intron-less form derived from human EF1α. 6-kb rabbit b-globin poly (A) sequence was truncated Jul 8, 2019 · Targeting genes to specific cell types is valuable for basic science and gene therapy. A subsequent study by Trojanowski and colleagues introduced an alternative approach in circumventing the problem with NT2N cells as a gene therapy tool by initially targeting the undifferentiated NT2 cells with a pseudotyped lentiviral vector encoding the human elongation factor 1-alpha promoter and the reporter gene eGFP ( Watson et al. The present study aimed to investigate whether it is possible to increase the levels of transgene expression by using various types of promoters to drive the expression of selected genes‑of‑interest. The FMC63 CAR transcript is 1. The PCR cycling conditions were as follows: four cycles of 95°C for 3 min. 2235688100 PubMed 14603031. 23. We have quantitatively compared promoter activities of five commonly used constitutive promoters, including the human β-actin promoter (ACTB), cytomegalovirus (CMV), elongation factor-1α, (EF1α), phosphoglycerate kinase (PGK) and ubiquitinC (UbC) in hESCs. As well; (iii) the 0. Lentiviral gene transfer was used to ensure stable Dec 4, 2020 · Promoter choice is an essential consideration for transgene expression in gene therapy. We compared the ability of the four promoters in transcribing GFP linked to an FMC63 CD19 CAR, the most studied CAR construct and the first CAR T cell design approved by the FDA. Elongation factor-Tu (EF-Tu, bacterial)/eukaryotic elongation factor 1α (eEF1α also known as eEF1A) is a critical factor for protein synthesis and is highly conserved across all three domains of life. 1b, d, left Dec 13, 2019 · The MH promoter activity was first analyzed via transient transfection of various striated muscle cell lines (H9C2 and C2C12) with comparison of the results for transfection with the DES, CMV, and EF1a gene promoters. 2018 Dec 27. Yang Yu. 2). The short CAG (sCAG) promoter is 868 bp long. Dec 15, 2017 · AAV-CaMKIIa-Cre virus, whose promoter is known as excitatory neuron-specific, was used as a negative control. Their equivalent to the eukaryotic TATA box, the Pribnow box (TATAAT) is located at the -10 position and is essential for transcription initiation. Teschendorf Oct 2, 2019 · We exposed EF1a-rtTA_TRE3G-mCherry and EF1a-rtTA_TRE3G-DDmCherry mESCs to saturating concentrations of Doxy (1000 ng/mL) and TMP (100 nM) for 24 h and checked for mCherry mRNA (Fig. Gain unparalleled visibility of your plasmids, DNA and protein sequences. Methods Animals Mar 10, 2011 · Here, we demonstrate that a back-to-back configuration of the mouse Pgk1 and human eukaryotic translation elongation factor 1 alpha 1 promoters provided a substantive increase in both transgene IY704: pMVP (L1-R5) EF1a promoter. Annotate features on your plasmids using the curated feature database. Mar 1, 2002 · The MCMV IE promoter was several fold stronger than the human cytomegalovirus (HCMV) immediate early (IE) promoter and the human elongation factor one alpha (EF-1 alpha) promoter in various Nov 25, 1994 · Most eukaryotic cells abundantly express polypeptide chain elongation factor-1 alpha (EF-1 alpha), an enzyme which catalyzes the GTP-dependent binding of aminoacyl-tRNA to ribosomes. This promoter drives expression of a human gene encoding the alpha subunit of elongation factor-1. eEF1A in its GTP-bound form binds and delivers aa-tRNAs to the A site of the ribosome. 11,13 We constructed human immunodeficiency virus-based SIN lentiviral vectors expressing canine CD18 from two different lengths of the human EF1a promoter/enhan-cer—a 233 bp fragment consisting of Aug 21, 2005 · The binding of eukaryotic translation elongation factor 1A (eEF1A) to actin is a noncanonical function that may link two distinct cellular processes, cytoskeleton organization and gene expression Jan 13, 2023 · Improving adeno-associated viral (AAV) vector-mediated transgene expression in retinal ganglion cells: comparison of five promoters Nov 2, 2016 · Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. The EF-1α promoter is commonly used in mammalian expression vectors. Jul 16, 1990 · We have characterized the promoter region of the human elongation factor 1α-encoding gene (EF-1α) and developed a versatile expression system which ha… Jul 24, 2020 · In this study, we compared four promoters for optimal expression of long RNA encoding multiple gene products in CAR T cells. . Feb 14, 2002 · The MCMV IE promoter was several fold stronger than the human cytomegalovirus (HCMV) immediate early (IE) promoter and the human elongation factor one alpha (EF-1 alpha) promoter in various mammalian cell lines such as NIH3T3, Neuro-2a, 293T or HT1080 and was only slightly weaker than the HCMV or the EF-1 alpha promoter in HeLa and CHO cell lines. Puromycin Growth in Bacteria. Expression vectors based on the elongation factor-1 alpha Feb 14, 2002 · In the present study, we compared the murine cytomegalovirus immediate early (MCMV IE) promoter and the human cytomegalovirus immediate early (HCMV IE) promoter containing the short stretch of 5′ untranslated region (UTR) in the absence or presence of the human elongation factor one alpha (EF-1α) first intron to direct foreign gene Dec 13, 2019 · One option is to use the ARTEMIS gene promoter consisting of a 1-kb sequence upstream of the translational start site, 15 which provides a much weaker (about 80% less) expression than the EF1a promoter in a luciferase reporter assay. Promoter systems comprised of two separate, divergent promoters may significantly increase the size of genetic cassettes intended for use in gene therapy. Promoter EF1a-HTLV Cloning Information Cloning method Restriction Enzyme 5′ cloning site NcoI (not destroyed) 3′ cloning site NotI (not destroyed) 5′ sequencing primer gttacagatccaagctgtgacc 3′ sequencing primer GATGAGTTTGGACAAACCAC (Common Sequencing Primers) Oct 31, 2019 · Alternatively, a variety of strong promoters, including human elongation factor-1 alpha (EF-1α) promoter and CAG promoter (a combination of the CMV immediate early enhancer and the chicken β-actin promoter), have been exploited to achieve the high-level expression of various genes [Citation 19, Citation 20]. Lentiviral deliviery of OFF VIPER CAR (anti-CD19)-candidate design (d+i) Jun 1, 2006 · The modified E1b promoter described in this paper is a compact promoter of 49 bp in length containing a typical TATA-box, 5′-TATATAAT-3′, for TBP binding, and an initiator element 5′-CATCGCGTCTCAGC-3′ from common carp (Carpio carpio) β-actin gene to control the transcriptional initiation whose last residue corresponds to the +1 Feb 18, 2010 · Short Communication; Published: Yamaguchi N, Sugano S . Thus, the inducible rtTA-TRE system can achieve high levels of Background: Silencing of the viral CMV immediate early enhancer promoter can be a problem in certain cell types when engineering stable cell lines. (A) The EF1a promoter- targeted ODN (Control) suppresses EF52 siRNA-directed H3K9me2 at the siRNA-targeted EF1a promoter, whereas treatment with the CCR5 promoter- speciﬁc ODN followed by treatment with EF52 siRNA (EF1a) does not. May 24, 2017 · The vector contains a U6 promoter-driven gRNA scaffold, an EF1a promoter-driven Cas9 fused to puromycin resistance gene and GFP with P2A peptides, and OriP/EBNA1 elements for the plasmid EF1-alpha promoter versions of the Tet-On 3G inducible expression system provide for consistent long-term expression of the Tet-On 3G transactivator, even in cell types known for their tendency to silence a CMV promoter over time, such as hematopoietic cells and stem cells. Aug 12, 2022 · To ensure the ubiquitous expression of the human ACE2 gene we used the human EF1a promoter. 5:e10611 (2010) View EFS: Human eukaryotic translation elongation factor 1 α1 short form: Medium-strength promoter. e. 2004 Jan 6. 2) [69]. al. Jul 24, 2007 · This EF1a promoter-associated RNA was detected by reverse transcription (RT), using either a polydTT or an EF1a promoter-specific primer ( Fig. 10. Here, we carried out a systematic comparison of eight commonly used constitutive promoters (SV40, CMV, UBC, EF1A, PGK and CAGG for mammalian systems, and COPIA and ACT5C for Drosophila systems). Christopher Newgard's lab contains the insert EF1a promoter and is published in Nucleic Acids Res. Feb 14, 2002 · In the present study, we compared the murine cytomegalovirus immediate early (MCMV IE) promoter and the human cytomegalovirus immediate early (HCMV IE) promoter containing the short stretch of 5′ untranslated region (UTR) in the absence or presence of the human elongation factor one alpha (EF-1α) first intron to direct foreign gene Aug 12, 2022 · In this work, we set out to create mice susceptible to the SARS-CoV-2 coronavirus. We also included in the comparison the TRE promoter, which can be activated by the rtTA transcriptional activator in a May 30, 2017 · In comparison with the CMV promoter, the eukaryotic translation elongation factor 1 α (EF-1α, gene symbol EEF1A1) promoter increased the transfection efficiency, the transgene expression, the proportion of expression-positive clones and the copy number of the episomal vector in long-term culture. Sichuan University. 1 publication Mar 20, 2012 · Hence, the elongation factor 1 alpha short promoter (EFS) in combination with elements from the β-globin locus (LCR-EFS) has been explored for ADA-SCID gene therapy to enhance expression in Jan 14, 2020 · Unique features of the targeting vector are the use of a promoter-less neomycin selection marker and the relatively short homology sequence on the 3′ end of the construct that allows for an efficient screening procedure of ES cell clones by PCR with primers that bind inside and outside of the Eef1a1 targeted region. Sep 20, 2022 · Knudsen SM, Frydenberg J, Clark BFC, Leffers H. We analyzed the sequence of the CAG promoter and then designed the hCMV-IEE which was combined by CAG enhancer and EF1-α to evaluate its effect on transgene expression in CHO cells. 25, 27 Even so, the CMV promoter has shown significantly increased transfection levels compared to the EF1a promoter, especially in hMSCs. Jan 30, 2008 · Background Eukaryotic elongation factor 1 alpha (eEF1A) is one of the four subunits composing eukaryotic translation elongation factor 1. Using pronuclear microinjection of the transgene construct, we obtained six founders with the insertion of the EF1a-hACE2 transgene, from which four independent mouse All lentiviral vectors with different internal promoters were able to transduce human NK cells; however, those containing the PGK promoter, the short form of the EF1A promoter (EFS), the SV40 viral promoter, or the hu-man cytomegalovirus (CMV) immediate early promoter showed the highest percentages of GFP+ NK cells (Figures 2A and 2B). Jun 23, 2020 · Four vectors that express enhanced green fluorescent protein (eGFP, 720 bp) under different promoters. On the vector map of pLentiCRISPR-E ( Fig. Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. The p(−3. Plasmid pEF-GFP from Dr. , 2001 Moreover, short promoters such as the human cytomegalovirus im-mediate-early enhancer and promoter (CMV; 600 bp)12or truncated versions of the human synapsin promoter (hSyn; 468 bp)13 are considerably weaker to drive gene transcription and expression, and in some cases, are completely repressed or inactivated only weeks after delivery. pii: 5264291. 14 Consistent with other published information, we generally test both the SFFV and EF1a promoters. truncatula and studied the salt stress response function of Dec 6, 2014 · MSCV promoter-driven vectors resulted in 33. Jul 31, 2019 · Established promoters, like the MCH promoter, should be used with caution since at high titers off-target expression occurs, which may impact specificity of the intended manipulation. The authors describe a collection of AAVs containing synthetic promoters targeting a broad range of neuronal Jul 24, 2020 · Promoter comparison for driving short transcripts. May 17, 2023 · In the current study, we analyzed the effects of four commonly used promoters (CAG, EF1a core, CMV, and PGK) on the CRISPR-Cas12a system, including cleaving activity, targeting specificity, multiplex editing efficiency, gene activation level, and base editing ability, which provided the basic information about the impact of promoters for the CRISPR gene-editing toolkit. EF-1α is one of the most abundant proteins in eukaryotic cells and is expressed in almost all kinds of mammalian cells. In this study, a series of deletion and scanning mutations was introduced in the promoter region of human EF-1 alpha … May 1, 2013 · Zebrafish is considered as a versatile experimental animal for various research models from development to diseases. Nucl Acids Res. Gene transfer into normal quiescent human B cells is a challenging procedure. It is a cellular-derived enhancer/promoter with decreased cross-activation of nearby promoters, therefore hypothetically decreasing the risk of genotoxicity. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetra-mers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Among the members of the family, eEF1α-related May 30, 2017 · The promoter and enhancer sequences are listed in Figure S2. 2. This promoter allows for an extra 570 bp in packaging capacity and provides low and neuronal-specific expression within the CNS. Acknowledgements May 30, 2020 · 2. 1073/pnas. , 60 Analyzing transfection data as a function of promoter revealed differences between the CMV and EF1a promoters, as the CMV promoter resulted in eight conditions (transfection efficiencies for conditions in which hAMSCs were transfected with MIPs; Figure 3A) out of 192 total conditions/replicates in quadrant 2 (Q2; i. We have characterized the promoter region of the human elongation factor 1 alpha-encoding gene (EF-1 alpha) and developed a versatile expression system which has a wide host range and a high efficiency of gene expression. , CMV and EF1a) are widely used promoters for gene delivery shown to produce high levels of transfection in numerous cell types. 76%, 33. 2 Upon formation of a correct codon-anticodon pair, a conformational change in the ribosome leads to GTP hydrolysis and release of eEF1A•GDP. Nov 28, 2013 · Both the CAG and elongation factor 1 alpha promoter have been reported to be more active in neurons. Dec 14, 2020 · Human elongation factor-1 alpha (EF-1 alpha) is a constitutive promoter of human origin that can be used to drive ectopic gene expression in various in vitro and in vivo contexts. 2 kb shorter than the GFP-Her2CAR-Mcl1. 1093/nar/gky1286. 33, 34, 35 We have demonstrated here that a short version of the CAG promoter, the sCAG SnapGene Viewer is free software that allows molecular biologists to create, browse, and share richly annotated sequence files. Our results suggest that promoter requirements are stringent for driving long RNA, and that EF-1 is the best choice for driving short or long RNA in CAR T cells, similar to an early study [ 31 ]. The EF-1α and CAG promoters (Fig. The expression of multiple genes requires ribosomal entry or skip sites, or the use of multiple promoters. Promoter EF1a Selectable markers. 1 A ). Jun 14, 2014 · Background Establishing highly productive clonal cell lines with constant productivity over 2–3 months of continuous culture remains a tedious task requiring the screening of tens of thousands of clonal colonies. In the 5'-promoter region, two interdependent cis-regulatory ele- ments were identified, and nuclear factors binding to these elements were detected in HeLa cells. Mar 13, 2023 · Background Elongation factor 1 A (EF1A), an essential regulator for protein synthesis, has been reported to participate in abiotic stress responses and environmental adaption in plants. Tissue-dependent variation in the expression of elongation factor-1 alpha isoforms: isolation and characterisation of a cDNA encoding a novel Most recent answer. , 2012). For cell types in which specific promoters are known to perform well, these promoters can be subcloned into our expression constructs. To ensure the ubiquitous expression of the human ACE2 gene we used the human EF1a promoter. Efficient cleavage requires at least two copies of the BspMI recognition sequence. Adeno Aug 26, 2010 · Methodology/Principal Findings. Proteins that lack a canonical RNA Apr 8, 2011 · In addition, the group has developed a short, 229-bp neuronal promoter derived from the MeCP2 transcription factor. Store, search, and share your sequences, files and maps. GenBank. To achieve directional cloning, Ase I and Nhe I restriction sites were introduced at the 5′ ends of the primers. Apr 20, 2017 · The elongation factor 1α short (EFS) promoter mediated the most robust expression, whereas expression levels were lower from the potent but more silencing-prone spleen focus forming virus Dec 6, 2014 · EF1alpha (or its short, intron-less form, EFS) is a promoter that has been recently used in many clinical trials. , high transgene expression Canonical Function of eEF1 in Translation Elongation . Promoters are about 100 to 1000 base pairs long and found upstream of their target genes. This plasmid is available through Addgene. EF-1 alpha is often useful in conditions where other promoters (such as CMV) have diminished activity or have been silenced (as in embryonic stem cells). Using pronuclear microinjection of the transgene construct, we obtained six founders with the insertion of the EF1a-hACE2 transgene, from which four independent mouse lines were established. (B) Immunocytochemistry results showing mCherry expression by Cre recombinase in the condition of treatment with two viruses, AAV-hALDH1L1-Cre and AAV-EF1a-DIO-mCherry viruses. Nov 1, 2002 · BACKGROUND Silencing of the viral CMV immediate early enhancer promoter can be a problem in certain cell types when engineering stable cell lines. Bacterial Resistance(s) Storage DNA can be stored at 4℃ (short term) or -20℃ (long term). 101 (1):16-22. Sequences (1) Addgene Sequences: Full (1) Full Sequences from Addgene (1) Based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or assembled from reference sequences and/or Sanger results (Addgene Assembled Sequence). Definition. Plasmid construction. 26 These authors compared pGK300-BBz with EF1A-BBz (pGK300 is a truncated promoter of phosphoglycerate kinase). 18:5322 (1990); PLoS One. The human CMV (hCMV) promoter has a size of 752 BfuAI is typically used at 50°C, but is 50% active at 37°C. Jul 16, 1990 · Abstract. The sequence of the promoter region controls the binding of the RNA polymerase and transcription factors, therefore Jun 11, 2021 · The influence of surface CAR expression on different promoter-driving CARs was also investigated by Guedan et. Apr 3, 2014 · In practice, the term "promoter" describes the combination of the promoter (RNA polymerase binding site) and operators (response elements). Here, we identified elongation factor (EF) genes of M. 11 LVs expressing ARTEMIS from its own promoter were not toxic in vitro or in vivo, enabling lymphoid Oct 16, 2015 · Human elongation factor-1 alpha (EF-1 alpha) is a constitutive promoter of human origin that can be used to drive ectopic gene expression in various in vitro and in vivo contexts. vp ov iq iy wr lg dl pf jl hk